Cracking the Code
During the late 1950s and early 1960s researchers were able to solve one of the major secrets of life, how genes worked. The problem the researchers were trying to solve was how a linear sequence of four nucleotides (A, G, C, and U) determined the amino acid sequence of proteins made up of twenty different amino acids. The simulation, TranslateIT, will allow you to reproduce some of the experiments that the scientists used to figure out how this was accomplished. Your mission, should you choose to accept it, is to crack the genetic code of life. This assingment is worth twenty points and is due the week of April 20th in discussion.
1. As having each nucleotide code for one amino acid would only allow for four different amino acids per protein, it was obvious to the researchers that there had to be some conversion between multiple bases and each amino acid. Would two nucleotides at a time be sufficient to provide enough different combinations (called codons) to code for all twenty amino acids? Why or why not? Will three nucleotides per codon work? Why or Why not?
2. A major step forward in figuring out the code was the discovery by Nirenberg in 1961 that a cell free extract made from E. coli cells could translate RNA added to the extract into proteins. The newly synthesized proteins composition could be determined by measuring the incorporation of radioactive amino acids. In his first experiment he made poly-U RNA, using the enzyme polynucleotide synthetase, and translated it into poly-phenylalanine using the cell-free extract. This was definitive proof that RNA could code for the synthesis of proteins and gave the first possible assignment of a nucleotide code to the amino acid it specified. Using TranslateIt, what does poly-U code for? What do the other three bases each code for?
3. While the Nirenberg experiments showed that RNA did determine the amino acids in the protein, they did not show how many bases were used for each codon, whether the codes were overlapping (is the second codon read from the second base [overlapping] or from the first base after the last base of the first codon [no overlap]), or whether there could be bases in-between the codons that did not code for anything (AUCGGGCAACGGGACAGGGGG, for instance, where the G's in between AUC, AAC and ACA aren't translated into amino acids - just like we use spaces to separate words in a sentence). Khorana developed a means to produce poly-dinucleotide and, later, poly-trinucleotide and poly-tetranucleotide sequences of DNA that could then be transcribed into RNA. These artificial RNA templates were translated in the cell free translation mix. If the code is read two bases at a time what result would you expect for a poly-dinucleotide such as ACACACAC? Try it and see whether your prediction was correct. From your results can you say whether the code is even or odd? Will you get a different result with CACACA than you did with ACACACAC? This result shows that in these crude extracts translation starts at a random location in the RNA sequence.
4. From what you've already discovered, what do you think will happen if you use a poly-trinucleotide such as AAC? Try it. Did you get the result you expected? Explain what happened. Will ACA or CAA give a different result? From these results can you now tell how many bases there are in a codon? If so, how many are there and how do you know this? Comparing this result to the result from the poly-dinucleotide AC can you now specify a codon for one of the amino acids incorporated by these templates? If so, which codon and amino acid go together? By elimination, can you assign another codon-amino acid pair? [hint: using what you know now look back at the dinucleotide experiment with AC] What is it? Try CAC next. Did the results support your codon assignment? Is there evidence here that one of the amino acids must have more than one codon that codes for it? If so, which one?
5. What do you think will happen if you translate a tetranucleotide? Try translating the tetranucleotide CAAG. Did you get the result you expected? Can you now assign a codon to any of the other amino acids that appeared in problem 4 above? [Don't worry about any new amino acids that showed up here, just solve the codons for the amino acids in problem 4] If so, what are they? Test your assignment with AACG. Did this confirm your results? Using the above data and any other experiments that are necessary, assign amino acids to all possible codons that do not include G or U, only various combinations of A and C.
6. Now try AU, AAU and AUU. Did you notice something different this time? What happened and how would you explain this unusual result? List any new codon assignments that you were able to make from these experiments. Use tetranucleotides to figure out the amino acids that go with the correct assignments for the codons that can be produced using only A and U. What unusual result did you see with some of the tetranucleotides and what is your explanation for this result?
7. Now try GGG, GGA, GGC, and GGU. What amino acid showed up in all four experiments? Are there any codons in common between these four reactions? If not, then what must be true to explain your results? Can you propose a codon or codons for the amino acid that showed up in all four experiments? Is there anything in common between the codons that you've just assigned to this amino acid? What is it? Use tetranucleotides to prove that your assignment is correct. Comparing these results to the ones above, can you say whether some positions in the codon are less important than others in specifying which amino acid is coded for?
